Journal: Scientific Reports

Article Title: Generation and characterization of a tamoxifen-inducible, Cre driver rat for transgene expression in microglia

doi: 10.1038/s41598-025-31077-z

Figure Lengend Snippet: Cx3cr1-CreERT2 rat creation and characterization overview. ( A ) The Cx3cr1-CreERT2 DNA was injected into Long Evans (LE) rat embryos. ( B ) The double-floxed inverted open reading frame (DIO) was used to produce the DIO-mCherry rat for Cre-dependent expression of the mCherry fluorescent protein in any cells that express Cre. ( C ) The DIO-mCherry rat was crossed with the Cx3cr1-CreERT2 and treated with tamoxifen (TAM) to fluorescently label Cx3cr1 expressing cells such as microglia in the brain. Created in BioRender. Harvey, B. (2025) https://BioRender.com/lf2aj0o .

Article Snippet: The open-reading-frame encoding iCre (based on pBSII-iCre , was amplified by PCR with linkered primers and inserted the BamHI and EcoRI sites of pOTTC293 (Addgene; #60057) using ligation-independent cloning (In-Fusion; Clontech).

Techniques: Injection, Expressing

Journal: Neuron

Article Title: Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.

doi: 10.1016/j.neuron.2019.01.035

Figure Lengend Snippet: Figure 3. Characterization of DAT-iCre Rats (A and B) Representative images of (A) in situ RNA hybridization and (B) immunohistochemical staining of the midbrain in WT and DAT-iCre transgenic rats. (A) Green, Cre; red, dopamine transporter (Dat); blue, DAPI staining. (B) Green, Cre; red, tyrosine hydroxylase (TH). Scale bars, 20 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LSL-Cas9 on Long Evans background This paper LE-(ROSA)26 em1(CAG-Cas9)Ottc; RGD ID: 1320822; RRRC ID: 833 LSL-nickase on Long Evans background This paper LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc; RGD ID: 13602097; RRRC ID: 834 Oligonucleotides Manf for:cggttgtgctactacattgga IDT N/A rev: gggccagaggcttcgatac probe: ccacagatgatgccgccaccaag Polr2a for: tagtcctacctactccccaacttc IDT N/A rev: agtagccaggagaagtgggag probe: actcgcccaccagtcccacctact Ube2i for: gccaccactgtttcatccaaa IDT N/A rev: gccgccagtccttgtcttc probe: cgtgtatccttctggcacagtgtgc TH Fwd: GAGAT GGCTACCACTAGCTCGAG IDT N/A TH Rev: GAGCCTGAGACAGGGTGATCC IDT N/A Rosa26 Fwd: GGGATTCCTCCTTGAGTTGTGGC IDT N/A Rosa26 Rev: GGAGGAGATATTCATCTGTAAACCATT AACAGG IDT N/A MANF Fwd: GCACTTAGGGGGTTCAGTGTATTC IDT N/A MANF Rev: CTACAAAAGCTGATGCTTCACCAGG IDT N/A TH seq F: CCAAAGGTTATAGTTCTAACATGAGCCCTTAG IDT N/A Rosa 26 seq R: AGCTACAGCCTCGATTTGTGGTG IDT N/A DAT-iCre Fwd: CGCACAAGCTGGGAGCTAATGTGAA IDT N/A DAT-iCre Rev: CTTCCAGGTGTGTTCAGAGAAG IDT N/A LSL-Cas9 50 junction Fwd: GGCTCCTCAGAGAGCCTCG IDT N/A LSL-Cas9 50 junction Rev: AGTTATGTAACGCGGAACTC CATATATGG IDT N/A LSL-Cas9 30 junction Fwd: CTGTGCCTTCTAGTTGCCAGCC IDT N/A LSL-Cas9 30 junction Rev: TTCTGCATTCCAGAAGGAACTA ACTTTTATAGAG IDT N/A LSL-Nickase 50 junction Fwd: GCTCAGAAAACTGGCCTTTG IDT N/A LSL-Nickase 30 junction Fwd: GAGGCGCTCACAGGTTCC IDT N/A Recombinant DNA PX551 Swiech et al., 2015 Addgene plasmid # 60957 pAAV MeCP2 HA-SpCas9n(D10A) This paper Addgene plasmid # 112719 pAAV TH gRNA A+B pair EF1a EGFP This paper Addgene plasmid # 113155 pAAV Rosa26 gRNA A+B EF1a EGFP This paper Addgene plasmid # 113156 pAAV MANF gRNA A+B EF1a EGFP This paper Addgene plasmid # 113157 pAAV (flox-stop) TH gRNA A EF1a eGFP This paper Addgene plasmid # 113158 pAAV CMV-IE Nuc-iRFP-2A-iCre This paper Addgene plasmid # 112683 pAAV CMV-IE Nuc-iRFP-2A-Flpo This paper Addgene plasmid # 112684 pAAV EF1a iCre This paper Addgene plasmid # 89760 pAAV EF1a Nuc-flox(mCherry)-EGFP This paper Addgene plasmid # 112677 pX458 with rat Rosa26 gRNA A This paper Addgene plasmid # 113161 prRosa26v1 LSL FLAG-SpCas9n NeoR This paper Addgene plasmid # 113162 prRosa26v2 LSL FLAG-SpCas9 This paper Addgene plasmid # 113163 pmU6(loxP-STOP-loxP) BbsI gRNA This paper Addgene plasmid # 113160 (Continued on next page) Neuron 102, 1–15.e1–e8, April 3, 2019 e2

Techniques: In Situ, Hybridization, Immunohistochemical staining, Staining, Transgenic Assay

Journal: Neuron

Article Title: Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.

doi: 10.1016/j.neuron.2019.01.035

Figure Lengend Snippet: Figure 4. Unilateral Injection of LSL-gRNA in Rats Expressing Cre in Dopaminergic Neurons Enables Region- and Cell-Type-Specific Th Editing (A and C) Representative images demonstrate unilateral loss of TH immunoreactivity in the (A) midbrain and (C) striatum of DAT-iCre rats (bottom), but not WT animals (top), 6 weeks following co-delivery of AAV Cas9 and AAV LSL-Th gRNA to the left (L) SN. GFP fluorescence represents transduction by AAV. (B) Quantification of optical density of TH immunoreactivity relative to DAPI in the ipsilateral compared to the contralateral SN of animals described in (A). Each point represents one analyzed coronal section (n = 3–4 sections/animal), and each color represents a distinct animal (n = 5–6/group, unpaired t test, t(9) = 4.166, **p = 0.0024). (D) Quantification of optical density of TH immunoreactivity relative to DAPI in the ipsilateral compared to the contralateral striatum of animals described in (C). Each point represents one analyzed coronal section (n = 3–4 sections/animal), and each color represents a distinct animal (n = 5–6/group, unpaired t test, t(11) = 2.896, *p = 0.0177). Scale bars, 500 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LSL-Cas9 on Long Evans background This paper LE-(ROSA)26 em1(CAG-Cas9)Ottc; RGD ID: 1320822; RRRC ID: 833 LSL-nickase on Long Evans background This paper LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc; RGD ID: 13602097; RRRC ID: 834 Oligonucleotides Manf for:cggttgtgctactacattgga IDT N/A rev: gggccagaggcttcgatac probe: ccacagatgatgccgccaccaag Polr2a for: tagtcctacctactccccaacttc IDT N/A rev: agtagccaggagaagtgggag probe: actcgcccaccagtcccacctact Ube2i for: gccaccactgtttcatccaaa IDT N/A rev: gccgccagtccttgtcttc probe: cgtgtatccttctggcacagtgtgc TH Fwd: GAGAT GGCTACCACTAGCTCGAG IDT N/A TH Rev: GAGCCTGAGACAGGGTGATCC IDT N/A Rosa26 Fwd: GGGATTCCTCCTTGAGTTGTGGC IDT N/A Rosa26 Rev: GGAGGAGATATTCATCTGTAAACCATT AACAGG IDT N/A MANF Fwd: GCACTTAGGGGGTTCAGTGTATTC IDT N/A MANF Rev: CTACAAAAGCTGATGCTTCACCAGG IDT N/A TH seq F: CCAAAGGTTATAGTTCTAACATGAGCCCTTAG IDT N/A Rosa 26 seq R: AGCTACAGCCTCGATTTGTGGTG IDT N/A DAT-iCre Fwd: CGCACAAGCTGGGAGCTAATGTGAA IDT N/A DAT-iCre Rev: CTTCCAGGTGTGTTCAGAGAAG IDT N/A LSL-Cas9 50 junction Fwd: GGCTCCTCAGAGAGCCTCG IDT N/A LSL-Cas9 50 junction Rev: AGTTATGTAACGCGGAACTC CATATATGG IDT N/A LSL-Cas9 30 junction Fwd: CTGTGCCTTCTAGTTGCCAGCC IDT N/A LSL-Cas9 30 junction Rev: TTCTGCATTCCAGAAGGAACTA ACTTTTATAGAG IDT N/A LSL-Nickase 50 junction Fwd: GCTCAGAAAACTGGCCTTTG IDT N/A LSL-Nickase 30 junction Fwd: GAGGCGCTCACAGGTTCC IDT N/A Recombinant DNA PX551 Swiech et al., 2015 Addgene plasmid # 60957 pAAV MeCP2 HA-SpCas9n(D10A) This paper Addgene plasmid # 112719 pAAV TH gRNA A+B pair EF1a EGFP This paper Addgene plasmid # 113155 pAAV Rosa26 gRNA A+B EF1a EGFP This paper Addgene plasmid # 113156 pAAV MANF gRNA A+B EF1a EGFP This paper Addgene plasmid # 113157 pAAV (flox-stop) TH gRNA A EF1a eGFP This paper Addgene plasmid # 113158 pAAV CMV-IE Nuc-iRFP-2A-iCre This paper Addgene plasmid # 112683 pAAV CMV-IE Nuc-iRFP-2A-Flpo This paper Addgene plasmid # 112684 pAAV EF1a iCre This paper Addgene plasmid # 89760 pAAV EF1a Nuc-flox(mCherry)-EGFP This paper Addgene plasmid # 112677 pX458 with rat Rosa26 gRNA A This paper Addgene plasmid # 113161 prRosa26v1 LSL FLAG-SpCas9n NeoR This paper Addgene plasmid # 113162 prRosa26v2 LSL FLAG-SpCas9 This paper Addgene plasmid # 113163 pmU6(loxP-STOP-loxP) BbsI gRNA This paper Addgene plasmid # 113160 (Continued on next page) Neuron 102, 1–15.e1–e8, April 3, 2019 e2

Techniques: Injection, Expressing, Transduction

Journal: Neuron

Article Title: Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.

doi: 10.1016/j.neuron.2019.01.035

Figure Lengend Snippet: Figure 5. Characterization and Use of an LSL-Cas9 Transgenic Rat for Cre-Dependent Knockout of TH (A) Representative confocal images of colocalization of iCre recombinase and the FLAG-tagged Cas9 transgene in LSL-Cas9 rats. FLAG immunoreactivity is not observed following delivery of Flpo, a non-Cre recombinase. iRFP fluorescence indicates comparable delivery of Flpo- and iCre-encoding viruses. (B) Representative confocal images of unilateral TH loss in the SN of LSL-Cas9 rats 4 weeks after a midbrain injection of AAV iCre and AAV control gRNAs (right side, top) or AAV Th gRNAs (left side, bottom). Comparable EGFP fluorescence in control and Th gRNAs-injected hemispheres indicates comparable viral delivery between conditions. (C) A TH-immunostained striatal section from a rat injected as in (B) (L, left side; R, right side). (D) Quantification of optical density of TH immunoreactivity in the SN and striatum of animals described in (B) and (C). Each data point represents one analyzed coronal section (n = 3–4 sections/animal), and each color represents a different animal (n = 4). Scale bars represent 50 mm (A), 100 mm (B), and 500 mm (C).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LSL-Cas9 on Long Evans background This paper LE-(ROSA)26 em1(CAG-Cas9)Ottc; RGD ID: 1320822; RRRC ID: 833 LSL-nickase on Long Evans background This paper LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc; RGD ID: 13602097; RRRC ID: 834 Oligonucleotides Manf for:cggttgtgctactacattgga IDT N/A rev: gggccagaggcttcgatac probe: ccacagatgatgccgccaccaag Polr2a for: tagtcctacctactccccaacttc IDT N/A rev: agtagccaggagaagtgggag probe: actcgcccaccagtcccacctact Ube2i for: gccaccactgtttcatccaaa IDT N/A rev: gccgccagtccttgtcttc probe: cgtgtatccttctggcacagtgtgc TH Fwd: GAGAT GGCTACCACTAGCTCGAG IDT N/A TH Rev: GAGCCTGAGACAGGGTGATCC IDT N/A Rosa26 Fwd: GGGATTCCTCCTTGAGTTGTGGC IDT N/A Rosa26 Rev: GGAGGAGATATTCATCTGTAAACCATT AACAGG IDT N/A MANF Fwd: GCACTTAGGGGGTTCAGTGTATTC IDT N/A MANF Rev: CTACAAAAGCTGATGCTTCACCAGG IDT N/A TH seq F: CCAAAGGTTATAGTTCTAACATGAGCCCTTAG IDT N/A Rosa 26 seq R: AGCTACAGCCTCGATTTGTGGTG IDT N/A DAT-iCre Fwd: CGCACAAGCTGGGAGCTAATGTGAA IDT N/A DAT-iCre Rev: CTTCCAGGTGTGTTCAGAGAAG IDT N/A LSL-Cas9 50 junction Fwd: GGCTCCTCAGAGAGCCTCG IDT N/A LSL-Cas9 50 junction Rev: AGTTATGTAACGCGGAACTC CATATATGG IDT N/A LSL-Cas9 30 junction Fwd: CTGTGCCTTCTAGTTGCCAGCC IDT N/A LSL-Cas9 30 junction Rev: TTCTGCATTCCAGAAGGAACTA ACTTTTATAGAG IDT N/A LSL-Nickase 50 junction Fwd: GCTCAGAAAACTGGCCTTTG IDT N/A LSL-Nickase 30 junction Fwd: GAGGCGCTCACAGGTTCC IDT N/A Recombinant DNA PX551 Swiech et al., 2015 Addgene plasmid # 60957 pAAV MeCP2 HA-SpCas9n(D10A) This paper Addgene plasmid # 112719 pAAV TH gRNA A+B pair EF1a EGFP This paper Addgene plasmid # 113155 pAAV Rosa26 gRNA A+B EF1a EGFP This paper Addgene plasmid # 113156 pAAV MANF gRNA A+B EF1a EGFP This paper Addgene plasmid # 113157 pAAV (flox-stop) TH gRNA A EF1a eGFP This paper Addgene plasmid # 113158 pAAV CMV-IE Nuc-iRFP-2A-iCre This paper Addgene plasmid # 112683 pAAV CMV-IE Nuc-iRFP-2A-Flpo This paper Addgene plasmid # 112684 pAAV EF1a iCre This paper Addgene plasmid # 89760 pAAV EF1a Nuc-flox(mCherry)-EGFP This paper Addgene plasmid # 112677 pX458 with rat Rosa26 gRNA A This paper Addgene plasmid # 113161 prRosa26v1 LSL FLAG-SpCas9n NeoR This paper Addgene plasmid # 113162 prRosa26v2 LSL FLAG-SpCas9 This paper Addgene plasmid # 113163 pmU6(loxP-STOP-loxP) BbsI gRNA This paper Addgene plasmid # 113160 (Continued on next page) Neuron 102, 1–15.e1–e8, April 3, 2019 e2

Techniques: Transgenic Assay, Knock-Out, Injection, Control

Journal: Neuron

Article Title: Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.

doi: 10.1016/j.neuron.2019.01.035

Figure Lengend Snippet: Figure 6. Developing an Assay for Knockout of MANF In Vivo (A) A schematic of the gRNA-binding sites and the PCR assay used to amplify the 893 nt flanking the second exon of rat Manf. (B–E) Rat primary cortical neurons were transduced with AAV Cas9 and AAV Manf gRNAs or AAV control gRNAs and harvested 1 week later for determination of mutagenesis and knockout. (B) Co-transduction with AAV Cas9 and AAV Manf gRNAs resulted in resolvase-induced cleavage of the PCR product (arrows). (C) An alignment of seven independently isolated clones of the PCR fragment shows precise +A insertions among the alleles. Knockout of Manf was verified with (D) real- time qRT-PCR and (E) Wes analyses of Manf mRNA and protein levels, respectively. (D) Manf mRNA levels were normalized to the geometric mean of reference genes and presented as 2ddCq ± upper and lower limits (n = 3, unpaired t test using dCq values, t(4) = 20.27, ****p < 0.0001). (E) The MANF protein band density was normalized to actin and presented as density relative to control gRNA (mean ± SE, n = 3, unpaired t test, t(4) = 4.999, **p = 0.0075). The arrow in the cropped blot points at the 25-kDa MANF band. (F) Representative images of unilateral loss of MANF immunoreactivity in the SN of LSL-Cas9 rats four weeks after co-injection of AAV iCre and AAV control gRNAs or AAV Manf gRNAs. GFP fluorescence represents delivery of gRNA. Scale bar 100 mm. (G) Quantification of the optical density of MANF immunoreactivity in the SN of LSL-Cas9 or WT animals injected as described in (F). Each data point represents one analyzed coronal section (n = 3–4/animal), and each color represents data from a distinct animal (n = 4/group, unpaired t test, t(6) = 5.437, **p = 0.0016).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LSL-Cas9 on Long Evans background This paper LE-(ROSA)26 em1(CAG-Cas9)Ottc; RGD ID: 1320822; RRRC ID: 833 LSL-nickase on Long Evans background This paper LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc; RGD ID: 13602097; RRRC ID: 834 Oligonucleotides Manf for:cggttgtgctactacattgga IDT N/A rev: gggccagaggcttcgatac probe: ccacagatgatgccgccaccaag Polr2a for: tagtcctacctactccccaacttc IDT N/A rev: agtagccaggagaagtgggag probe: actcgcccaccagtcccacctact Ube2i for: gccaccactgtttcatccaaa IDT N/A rev: gccgccagtccttgtcttc probe: cgtgtatccttctggcacagtgtgc TH Fwd: GAGAT GGCTACCACTAGCTCGAG IDT N/A TH Rev: GAGCCTGAGACAGGGTGATCC IDT N/A Rosa26 Fwd: GGGATTCCTCCTTGAGTTGTGGC IDT N/A Rosa26 Rev: GGAGGAGATATTCATCTGTAAACCATT AACAGG IDT N/A MANF Fwd: GCACTTAGGGGGTTCAGTGTATTC IDT N/A MANF Rev: CTACAAAAGCTGATGCTTCACCAGG IDT N/A TH seq F: CCAAAGGTTATAGTTCTAACATGAGCCCTTAG IDT N/A Rosa 26 seq R: AGCTACAGCCTCGATTTGTGGTG IDT N/A DAT-iCre Fwd: CGCACAAGCTGGGAGCTAATGTGAA IDT N/A DAT-iCre Rev: CTTCCAGGTGTGTTCAGAGAAG IDT N/A LSL-Cas9 50 junction Fwd: GGCTCCTCAGAGAGCCTCG IDT N/A LSL-Cas9 50 junction Rev: AGTTATGTAACGCGGAACTC CATATATGG IDT N/A LSL-Cas9 30 junction Fwd: CTGTGCCTTCTAGTTGCCAGCC IDT N/A LSL-Cas9 30 junction Rev: TTCTGCATTCCAGAAGGAACTA ACTTTTATAGAG IDT N/A LSL-Nickase 50 junction Fwd: GCTCAGAAAACTGGCCTTTG IDT N/A LSL-Nickase 30 junction Fwd: GAGGCGCTCACAGGTTCC IDT N/A Recombinant DNA PX551 Swiech et al., 2015 Addgene plasmid # 60957 pAAV MeCP2 HA-SpCas9n(D10A) This paper Addgene plasmid # 112719 pAAV TH gRNA A+B pair EF1a EGFP This paper Addgene plasmid # 113155 pAAV Rosa26 gRNA A+B EF1a EGFP This paper Addgene plasmid # 113156 pAAV MANF gRNA A+B EF1a EGFP This paper Addgene plasmid # 113157 pAAV (flox-stop) TH gRNA A EF1a eGFP This paper Addgene plasmid # 113158 pAAV CMV-IE Nuc-iRFP-2A-iCre This paper Addgene plasmid # 112683 pAAV CMV-IE Nuc-iRFP-2A-Flpo This paper Addgene plasmid # 112684 pAAV EF1a iCre This paper Addgene plasmid # 89760 pAAV EF1a Nuc-flox(mCherry)-EGFP This paper Addgene plasmid # 112677 pX458 with rat Rosa26 gRNA A This paper Addgene plasmid # 113161 prRosa26v1 LSL FLAG-SpCas9n NeoR This paper Addgene plasmid # 113162 prRosa26v2 LSL FLAG-SpCas9 This paper Addgene plasmid # 113163 pmU6(loxP-STOP-loxP) BbsI gRNA This paper Addgene plasmid # 113160 (Continued on next page) Neuron 102, 1–15.e1–e8, April 3, 2019 e2

Techniques: Knock-Out, In Vivo, Binding Assay, Transduction, Control, Mutagenesis, Isolation, Clone Assay, Quantitative RT-PCR, Injection

Journal: Neuron

Article Title: Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats.

doi: 10.1016/j.neuron.2019.01.035

Figure Lengend Snippet: Figure 8. Characterization and Use of the LSL-Cas9 3 DAT-iCre Double-Transgenic Rat for Knockout of MANF in the Midbrain Dopaminergic Neurons (A) Representative confocal images of TH and FLAG-tagged Cas9 colocalization in the SN of LSL-Cas9 3 DAT-iCre double-transgenic rats. (B) Representative midbrain images depicting unilateral loss of MANF immunoreactivity (white arrowheads) in TH+ dopaminergic cells in LSL-Cas9 3 DAT-iCre rats 4 weeks following injection of AAV control or AAV Manf gRNAs into the SN. (C) High-magnification confocal images acquired 4 weeks after AAV injection demonstrating selective loss of MANF immunoreactivity in TH+ cells that received Manf gRNAs (right), but not in those that received control gRNAs (left). GFP fluorescence indicates viral transduction. Open arrowheads signal to GFP+TH cells in which MANF immunoreactivity is maintained in both control and experimental conditions. Closed arrowheads signal to GFP+TH+ cells in which MANF immunoreactivity is lost in the hemisphere receiving Manf gRNAs, but not control.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LSL-Cas9 on Long Evans background This paper LE-(ROSA)26 em1(CAG-Cas9)Ottc; RGD ID: 1320822; RRRC ID: 833 LSL-nickase on Long Evans background This paper LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc; RGD ID: 13602097; RRRC ID: 834 Oligonucleotides Manf for:cggttgtgctactacattgga IDT N/A rev: gggccagaggcttcgatac probe: ccacagatgatgccgccaccaag Polr2a for: tagtcctacctactccccaacttc IDT N/A rev: agtagccaggagaagtgggag probe: actcgcccaccagtcccacctact Ube2i for: gccaccactgtttcatccaaa IDT N/A rev: gccgccagtccttgtcttc probe: cgtgtatccttctggcacagtgtgc TH Fwd: GAGAT GGCTACCACTAGCTCGAG IDT N/A TH Rev: GAGCCTGAGACAGGGTGATCC IDT N/A Rosa26 Fwd: GGGATTCCTCCTTGAGTTGTGGC IDT N/A Rosa26 Rev: GGAGGAGATATTCATCTGTAAACCATT AACAGG IDT N/A MANF Fwd: GCACTTAGGGGGTTCAGTGTATTC IDT N/A MANF Rev: CTACAAAAGCTGATGCTTCACCAGG IDT N/A TH seq F: CCAAAGGTTATAGTTCTAACATGAGCCCTTAG IDT N/A Rosa 26 seq R: AGCTACAGCCTCGATTTGTGGTG IDT N/A DAT-iCre Fwd: CGCACAAGCTGGGAGCTAATGTGAA IDT N/A DAT-iCre Rev: CTTCCAGGTGTGTTCAGAGAAG IDT N/A LSL-Cas9 50 junction Fwd: GGCTCCTCAGAGAGCCTCG IDT N/A LSL-Cas9 50 junction Rev: AGTTATGTAACGCGGAACTC CATATATGG IDT N/A LSL-Cas9 30 junction Fwd: CTGTGCCTTCTAGTTGCCAGCC IDT N/A LSL-Cas9 30 junction Rev: TTCTGCATTCCAGAAGGAACTA ACTTTTATAGAG IDT N/A LSL-Nickase 50 junction Fwd: GCTCAGAAAACTGGCCTTTG IDT N/A LSL-Nickase 30 junction Fwd: GAGGCGCTCACAGGTTCC IDT N/A Recombinant DNA PX551 Swiech et al., 2015 Addgene plasmid # 60957 pAAV MeCP2 HA-SpCas9n(D10A) This paper Addgene plasmid # 112719 pAAV TH gRNA A+B pair EF1a EGFP This paper Addgene plasmid # 113155 pAAV Rosa26 gRNA A+B EF1a EGFP This paper Addgene plasmid # 113156 pAAV MANF gRNA A+B EF1a EGFP This paper Addgene plasmid # 113157 pAAV (flox-stop) TH gRNA A EF1a eGFP This paper Addgene plasmid # 113158 pAAV CMV-IE Nuc-iRFP-2A-iCre This paper Addgene plasmid # 112683 pAAV CMV-IE Nuc-iRFP-2A-Flpo This paper Addgene plasmid # 112684 pAAV EF1a iCre This paper Addgene plasmid # 89760 pAAV EF1a Nuc-flox(mCherry)-EGFP This paper Addgene plasmid # 112677 pX458 with rat Rosa26 gRNA A This paper Addgene plasmid # 113161 prRosa26v1 LSL FLAG-SpCas9n NeoR This paper Addgene plasmid # 113162 prRosa26v2 LSL FLAG-SpCas9 This paper Addgene plasmid # 113163 pmU6(loxP-STOP-loxP) BbsI gRNA This paper Addgene plasmid # 113160 (Continued on next page) Neuron 102, 1–15.e1–e8, April 3, 2019 e2

Techniques: Transgenic Assay, Knock-Out, Injection, Control, Transduction